FUGW-PK-hLC3∆G
(Plasmid #61461)

• Purpose: Express pHluorin-mKate2-hLC3∆G (PK-hLC3∆G), a negative control for pHluorin-mKate2-hLC3 (PK-hLC3), in mammalian cells for monitoring autophagy, based on FUGW (3rd gen lentiviral plasmid)
• Depositing Lab: Isei Tanida
• Publication: Tanida et al PLoS One. 2014 Oct 23;9(10):e110600. doi: 10.1371/journal.pone.0110600. eCollection 2014.

Backbone

• Vector backbone: FUGW
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 11000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PK-hLC3∆G
• Alt name: pHluorin-mKate2-hLC3∆G
• Species: H. sapiens (human)
• Entrez Gene: MAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
• Promoter: hUBC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TGTGGACAGAAGACTGGAAAG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We thank Dr. James Edward Rothman for providing respective pHluorin.