pFF749
(Plasmid
#61452)
-
PurposeIPTG-inducible msd_kanR(ON)_dRT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61452 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZE32
-
Backbone manufacturerExpressys
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemsd_kanR(ON)_dRT
-
SpeciesE. coli
-
MutationD197A D198A
- Promoter pLacO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAAGAAACCATTATTATCATGAC
- 3′ sequencing primer GGGCGGCGGATTTGTCCTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFF749 was a gift from Timothy Lu (Addgene plasmid # 61452 ; http://n2t.net/addgene:61452 ; RRID:Addgene_61452) -
For your References section:
Synthetic biology. Genomically encoded analog memory with precise in vivo DNA writing in living cell populations. Farzadfard F, Lu TK. Science. 2014 Nov 14;346(6211):1256272. doi: 10.1126/science.1256272. 10.1126/science.1256272 PubMed 25395541