Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBW414hrpL-cIgfp
(Plasmid #61439)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61439 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSB4A3
  • Backbone manufacturer
    BioBrick registry
  • Backbone size w/o insert (bp) 3547
  • Total vector size (bp) 5428
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HrpL-rbs34-CI-LVA-t-plam-30gfp-t
  • Species
    Synthetic
  • Insert Size (bp)
    2089
  • Promoter HrpL
  • Tag / Fusion Protein
    • LVA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was created by ​Dr Baojun Wang
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBW414hrpL-cIgfp was a gift from Martin Buck & Baojun Wang (Addgene plasmid # 61439 ; http://n2t.net/addgene:61439 ; RRID:Addgene_61439)
  • For your References section:

    Engineering modular and orthogonal genetic logic gates for robust digital-like synthetic biology. Wang B, Kitney RI, Joly N, Buck M. Nat Commun. 2011 Oct 18;2:508. doi: 10.1038/ncomms1516. 10.1038/ncomms1516 PubMed 22009040