pBW213ara-hrpS
(Plasmid
#61435)
-
PurposepBAD18-cm encoding rbs33-hrpS-ter
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBAD18-Cm
- Backbone size w/o insert (bp) 6026
- Total vector size (bp) 7094
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerbs33-hrpS-ter
-
SpeciesSynthetic
-
Insert Size (bp)1087
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was created by Dr Baojun Wang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBW213ara-hrpS was a gift from Martin Buck & Baojun Wang (Addgene plasmid # 61435 ; http://n2t.net/addgene:61435 ; RRID:Addgene_61435) -
For your References section:
Engineering modular and orthogonal genetic logic gates for robust digital-like synthetic biology. Wang B, Kitney RI, Joly N, Buck M. Nat Commun. 2011 Oct 18;2:508. doi: 10.1038/ncomms1516. 10.1038/ncomms1516 PubMed 22009040
Map uploaded by the depositor.
