-
Purpose(Empty Backbone) Lentiviral vector for RFP657 NHEJ reporter system expression. Allows insertion of target sites between the SFFV promoter and RFP657 for detection of fluorescence knockdown. Puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneRRL.PPT.SFFV.RFP657.IRES2.PAC.PRE
- Backbone size (bp) 8626
-
Vector typeMammalian Expression, Lentiviral
- Promoter SFFV
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAG
- 3′ sequencing primer TGACAGGTGGTGGCAATGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDirk Heckl
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL-SFFV.Reporter.RFP657.PAC was a gift from Benjamin Ebert (Addgene plasmid # 61395 ; http://n2t.net/addgene:61395 ; RRID:Addgene_61395) -
For your References section:
Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. 10.1038/nbt.2951 PubMed 24952903