QUAS:GFP;betacrystallin:CFP
(Plasmid
#61376)
-
PurposeQUAS driving GFP with beta crystalline CFP eye marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61376 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST TOL2 pA2
-
Backbone manufacturerChien Lab
- Backbone size w/o insert (bp) 3966
- Total vector size (bp) 6738
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQUAS:GFP;beta crys:CFP
-
Insert Size (bp)2772
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAATCCTGCAGTGCTGAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
QUAS:GFP;betacrystallin:CFP was a gift from Marnie Halpern (Addgene plasmid # 61376) -
For your References section:
Adoption of the Q transcriptional regulatory system for zebrafish transgenesis. Subedi A, Macurak M, Gee ST, Monge E, Goll MG, Potter CJ, Parsons MJ, Halpern ME. Methods. 2014 Apr 1;66(3):433-40. doi: 10.1016/j.ymeth.2013.06.012. Epub 2013 Jun 20. 10.1016/j.ymeth.2013.06.012 PubMed 23792917