Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcrRNA.con
(Plasmid #61285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD18
  • Backbone size (bp) 3399
  • Vector type
    Bacterial Expression, CRISPR
  • Promoter J23119

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tgctcatgtttgacagcttatcatc
  • 3′ sequencing primer GGCTGAAAATCTTCTCTCATCCGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcrRNA.con was a gift from Chase Beisel (Addgene plasmid # 61285 ; http://n2t.net/addgene:61285 ; RRID:Addgene_61285)
  • For your References section:

    Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression. Luo ML, Mullis AS, Leenay RT, Beisel CL. Nucleic Acids Res. 2014 Oct 17. pii: gku971. 10.1093/nar/gku971 PubMed 25326321