pMM178
(Plasmid #61270)

• Purpose: Also referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance.
• Depositing Lab: Timothy Lu
• Publication: Citorik et al Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.

Backbone

• Vector backbone: Custom pBBR1-CmR
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cas9, tracrRNA, crRNA
• Alt name: CRISPR/Cas
• Species: Streptococcus pyogenes
• Insert Size (bp): 5008
• Promoter: pLtetO, native, native (respectively)
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ACGTCTCATTTTCGCCAGAT
• 3′ sequencing primer: GAGAAAGCAGGTAGCTTGCAG

Resource Information

• Supplemental Documents:
  • Annotated pMM178
• A portion of this plasmid was derived from a plasmid made by: The Cas9 enzyme was originally cloned from addgene plasmid 39312 (pMJ806). The tracrRNA and crRNA were synthesized.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry