pAWP89
(Plasmid #61264)

• Purpose: IncP-based replicating vector expressing dTomato under tac promoter.
• Depositing Lab: Mary Lidstrom
• Publication: Puri et al Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14.

Backbone

• Vector backbone: pAWP78
• Total vector size (bp): 5756
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ptac-dTomato
• Insert Size (bp): 777
• GenBank ID: AY678268.1
• Promoter: tac

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGAAAGGCGGACAGGTATC

Resource Information

• Supplemental Documents:
  • pAWP89.gb
• A portion of this plasmid was derived from a plasmid made by: dTomato from pUltra-Chili-Luc (Addgene plasmid #48688 https://www.addgene.org/48688/)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

dTomato reference:
Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037