Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAWP78
(Plasmid #61263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61263 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCM66
  • Backbone size (bp) 4979
  • Modifications to backbone
    Minimized vector size by removing fragments of tet and bla antibiotic resistance genes left over from restriction based cloning.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):

AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT
AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAWP78 was a gift from Mary Lidstrom (Addgene plasmid # 61263 ; http://n2t.net/addgene:61263 ; RRID:Addgene_61263)
  • For your References section:

    Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14. 10.1128/AEM.03795-14 PubMed 25548049