pJW1285
(Plasmid #61252)

• Purpose: CRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegans
• Depositing Lab: Jordan Ward
• Publication: Ward et al Genetics. 2014 Dec 9. pii: genetics.114.172361.

Backbone

• Vector backbone: pJW1219
• Backbone manufacturer: Jordan Ward
• Backbone size w/o insert (bp): 8146
• Total vector size (bp): 8146
• Modifications to backbone: Replaced the sgRNA target sequence in the backbone with a sequence targeting the pha-1 locus near the e2123 allele.
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA(F+E) targeting pha-1
• Species: Synthetic
• Insert Size (bp): 123

Resource Information

• Supplemental Documents:
  • pJW1285
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Target sequence: atgaataacttgatgaacat