pJW1219
(Plasmid #61250)

• Purpose: CRISPR/Cas9 plasmid containing sgRNA(F+E); for use in C. elegans
• Depositing Lab: Jordan Ward
• Publication: Ward et al Genetics. 2014 Dec 9. pii: genetics.114.172361.

Backbone

• Vector backbone: pDD162
• Backbone manufacturer: Goldstein lab
• Backbone size w/o insert (bp): 8113
• Total vector size (bp): 8148
• Modifications to backbone: Original sgRNA has been replaced with the improved synthetic guide RNA, sgRNA(F+E) (Chen et al., 2013, Cell). Contains an sgRNA sequence targeting the Y61A9LA.1 gene (Friedland et al., 2013, Nature Methods).
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA(F+E)
• Species: Synthetic
• Insert Size (bp): 123
• Promoter: U6 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: attgtgttcgttgagtgaccc
• 3′ sequencing primer: ggtgtgaaataccgcacaga

Resource Information

• Supplemental Documents:
  • Annotated plasmid sequence
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

target sequence: ggatggatgtgtagtcaatt