Skip to main content
Addgene

CMV-REX-GECO1
(Plasmid #61246)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61246 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4454
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REX-GECO1
  • Alt name
    Red excitation ratiometric genetically encoded Ca2+-indicators for optical version 1
  • Species
    Synthetic
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, S142P, D147V, E148G, P220L, N257I, A302P, M339L, T382S
  • GenBank ID
    KP091743
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construct is numbered based on GCaMP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-REX-GECO1 was a gift from Robert Campbell (Addgene plasmid # 61246 ; http://n2t.net/addgene:61246 ; RRID:Addgene_61246)

  • For your References section:

    A long Stokes shift red fluorescent Ca(2+) indicator protein for two-photon and ratiometric imaging. Wu J, Abdelfattah AS, Miraucourt LS, Kutsarova E, Ruangkittisakul A, Zhou H, Ballanyi K, Wicks G, Drobizhev M, Rebane A, Ruthazer ES, Campbell RE. Nat Commun. 2014 Oct 31;5:5262. doi: 10.1038/ncomms6262. 10.1038/ncomms6262 PubMed 25358432
Related items:
Commonly requested with: