Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMV-ER-LAR-GECO1
(Plasmid #61244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61244 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4514
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LAR-GECO1
  • Alt name
    low affinity red intensiometric genetically encoded Ca2+-indicators for optical
  • Species
    Synthetic
  • Insert Size (bp)
    1248
  • Mutation
    Substitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I
  • GenBank ID
    KP091742
  • Promoter CMV
  • Tags / Fusion Proteins
    • ER-targeting sequence: MLLPVPLLLGLLGAAAD (N terminal on insert)
    • ER-retention sequence: KDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construct is numbered based on GCaMP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-ER-LAR-GECO1 was a gift from Robert Campbell (Addgene plasmid # 61244 ; http://n2t.net/addgene:61244 ; RRID:Addgene_61244)
  • For your References section:

    Red fluorescent genetically encoded Ca2+ indicators for use in mitochondria and endoplasmic reticulum. Wu J, Prole DL, Shen Y, Lin Z, Gnanasekaran A, Liu Y, Chen L, Zhou H, Chen SR, Usachev YM, Taylor CW, Campbell RE. Biochem J. 2014 Nov 15;464(1):13-22. doi: 10.1042/BJ20140931. 10.1042/BJ20140931 PubMed 25164254