Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiX2-PURO-shLKB1-Ms
(Plasmid #61231)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61231 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiX2-PURO
  • Backbone manufacturer
    Eric Campeau
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shLkb1 (Ms/Hu)
  • gRNA/shRNA sequence
    CGCCAAGCTCATCGGCAAGTA
  • Species
    H. sapiens (human), M. musculus (mouse)
  • GenBank ID
    NM_011492.4
  • Entrez Gene
    Stk11 (a.k.a. Lkb1, Par-4)
  • Promoter H1/TO

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiX2-PURO-shLKB1-Ms was a gift from Reuben Shaw (Addgene plasmid # 61231 ; http://n2t.net/addgene:61231 ; RRID:Addgene_61231)
  • For your References section:

    An AMPK-independent signaling pathway downstream of the LKB1 tumor suppressor controls Snail1 and metastatic potential. Goodwin JM, Svensson RU, Lou HJ, Winslow MM, Turk BE, Shaw RJ. Mol Cell. 2014 Aug 7;55(3):436-50. doi: 10.1016/j.molcel.2014.06.021. Epub 2014 Jul 17. 10.1016/j.molcel.2014.06.021 PubMed 25042806