pLentiX2-PURO-shGFP
(Plasmid
#61230)
-
PurposeLentivirus expressing shRNA to GFP
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiX2-PURO
-
Backbone manufacturerEric Campeau
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceGAAGCAGCACGACTTCTTCT
-
SpeciesSynthetic
- Promoter H1/TO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer H1 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiX2-PURO-shGFP was a gift from Reuben Shaw (Addgene plasmid # 61230 ; http://n2t.net/addgene:61230 ; RRID:Addgene_61230) -
For your References section:
An AMPK-independent signaling pathway downstream of the LKB1 tumor suppressor controls Snail1 and metastatic potential. Goodwin JM, Svensson RU, Lou HJ, Winslow MM, Turk BE, Shaw RJ. Mol Cell. 2014 Aug 7;55(3):436-50. doi: 10.1016/j.molcel.2014.06.021. Epub 2014 Jul 17. 10.1016/j.molcel.2014.06.021 PubMed 25042806