pMTB-Multibow-hG
(Plasmid #60994)

• Purpose: Part of Multibow set of constructs--each FP gene is initially not expressed and then adopts a permanent ON or OFF status upon Cre-mediated recombination. . Encodes nuclear EGFP
• Depositing Lab: Sean Megason
• Publication: Xiong et al PLoS One. 2015 May 26;10(5):e0127822. doi: 10.1371/journal.pone.0127822. eCollection 2015.

Backbone

• Vector backbone: pMTB
• Vector type: Zebrafish

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: Synthetic
• Promoter: Bactin2
• Tag / Fusion Protein:
  • histone 2B tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: SP6
• 3′ sequencing primer: CAGCAGGACCATTTATCATGCTGCTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.