Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJET1.2-STOP-dsRed
(Plasmid #60944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60944 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJET1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 4785
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dsRED
  • Alt name
    RFP
  • Promoter 3XP3

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgactcactatagggagagcggc
  • 3′ sequencing primer aagaacatcgattttccatggcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid contains an IS4-like element that does not interfere with function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2-STOP-dsRed was a gift from Frank Schnorrer (Addgene plasmid # 60944 ; http://n2t.net/addgene:60944 ; RRID:Addgene_60944)
  • For your References section:

    A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. Zhang X, Koolhaas WH, Schnorrer F. G3 (Bethesda). 2014 Oct 15. pii: g3.114.013979. doi: 10.1534/g3.114.013979. 10.1534/g3.114.013979 PubMed 25324299