pPHT-PIP2
(Plasmid #60937)

• Purpose: Fluorescent FPX sensor for PIP2
• Depositing Lab: Anne Marie Quinn
• Publication: Ding et al Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261.

Backbone

• Vector backbone: pUB2.1
• Total vector size (bp): 8093
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PIP2 dimerization dependent sensor RA+B monomers
• Species: Synthetic
• Insert Size (bp): 2604
• Promoter: CMV
• Tag / Fusion Protein:
  • dimerization dependent fluorescent protein monomers RA+B

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: atggtgagcaagagcgaggag
• 3′ sequencing primer: ctggatgttgagctccttcaggaag

Resource Information

• Supplemental Documents:
  • protocol
• A portion of this plasmid was derived from a plasmid made by: The dimerization-dependent fluorescent protein component of the plasmid was received from Robert Campbell and was originally described in the manuscript below. Alford, S.C., Abdelfattah, A.S., Ding, Y., and Campbell, R.E. (2012). A fluorogenic red fluorescent protein heterodimer. Chem. Biol. 19, 353-360.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.