pPL5606_TEF1*-Cre_ADE2
(Plasmid #60932)

• Purpose: Constitutive expression vector for Cre-recombinase containing ADE2 selection marker.
• Depositing Lab: Robert Piper
• Publication: MacDonald et al Yeast. 2015 Feb 16. doi: 10.1002/yea.3069.

Backbone

• Vector backbone: pSH47
• Vector type: Yeast Expression
• Selectable markers: ADE2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cre
• Alt name: Cre-recombinase
• Species: E. coli
• Insert Size (bp): 1032
• Promoter: mutant TEF1
• Tag / Fusion Protein:
  • Driven from a mutant TEF1 promoter with 0.16x activity

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: catattttccgtcgatgttgaaatcc
• 3′ sequencing primer: cgataccgtcgaggggcagagcc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: They were gene synthesized using a commercial service, which made them according to our design.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains I100V, K245R and F258L mutations in the ADE2 gene that do not impact selection or plasmid function.