pTight-9-124-BclxL
(Plasmid #60857)

• Purpose: 2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoter
• Depositing Lab: Andrew Yoo
• Publication: Victor et al Neuron. 2014 Oct 22;84(2):311-23. doi: 10.1016/j.neuron.2014.10.016. Epub 2014 Oct 22.

Backbone

• Vector backbone: pTLemiR
• Backbone manufacturer: Homemade
• Backbone size w/o insert (bp): 10335
• Total vector size (bp): 11706
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miR-9/9*-miR-124-BCLxL
• Alt name: microRNA 9, microRNA 124, BCL2-like 1
• Species: M. musculus (mouse)
• Insert Size (bp): 1371
• GenBank ID: NR_029818 NR_029814 NM_138578.1
• Entrez Gene: BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
• Promoter: pTight

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGCGCTGCCACCATGTCTCA
• 3′ sequencing primer: GCACACCGGCCTTATTCCAAG

Resource Information

• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry