Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJDC182
(Plasmid #60854)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60854 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJDC89
  • Backbone manufacturer
    JD Cirillo
  • Backbone size w/o insert (bp) 4809
  • Total vector size (bp) 6485
  • Vector type
    Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase (optimized for Mycobacteria)
  • Alt name
    FFLux
  • Species
    Photinus pyralis (firefly)
  • Insert Size (bp)
    1650
  • Mutation
    codon optimized for Mycobacteria
  • GenBank ID
    JQ031641
  • Promoter hsp60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer AGGAGGATAACATATGGAAGATGC
  • 3′ sequencing primer CAGCTTCGACTTGCCTCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJDC182 was a gift from Jeffrey Cirillo (Addgene plasmid # 60854 ; http://n2t.net/addgene:60854 ; RRID:Addgene_60854)
  • For your References section:

    Real-time bioluminescence imaging of mixed mycobacterial infections. Chang M, Anttonen KP, Cirillo SL, Francis KP, Cirillo JD. PLoS One. 2014 Sep 29;9(9):e108341. doi: 10.1371/journal.pone.0108341. eCollection 2014. 10.1371/journal.pone.0108341 PubMed 25265287