pJDC182
(Plasmid
#60854)
-
PurposeExpresses firefly luciferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJDC89
-
Backbone manufacturerJD Cirillo
- Backbone size w/o insert (bp) 4809
- Total vector size (bp) 6485
-
Vector typeBacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase (optimized for Mycobacteria)
-
Alt nameFFLux
-
SpeciesPhotinus pyralis (firefly)
-
Insert Size (bp)1650
-
Mutationcodon optimized for Mycobacteria
-
GenBank IDJQ031641
- Promoter hsp60
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer AGGAGGATAACATATGGAAGATGC
- 3′ sequencing primer CAGCTTCGACTTGCCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJDC182 was a gift from Jeffrey Cirillo (Addgene plasmid # 60854 ; http://n2t.net/addgene:60854 ; RRID:Addgene_60854) -
For your References section:
Real-time bioluminescence imaging of mixed mycobacterial infections. Chang M, Anttonen KP, Cirillo SL, Francis KP, Cirillo JD. PLoS One. 2014 Sep 29;9(9):e108341. doi: 10.1371/journal.pone.0108341. eCollection 2014. 10.1371/journal.pone.0108341 PubMed 25265287