pCAS
(Plasmid #60847)

• Purpose: Expresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeast
• Depositing Lab: Jamie Cate
• Publication: Ryan et al Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703.

Backbone

• Vector backbone: 2-micron/pUC
• Total vector size (bp): 8761
• Vector type: Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
• Selectable markers: G418

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: S. pyogenese Cas9
• Species: streptococcus pyogenes
• Insert Size (bp): 4104
• Tag / Fusion Protein:
  • NLS/His8 (C terminal on insert)

Gene/Insert 2

• Gene/Insert name: RNA pol III promoter (tRNA-Tyr)
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 132

Gene/Insert 3

• Gene/Insert name: hepatitis delta virus ribozyme, genomic
• Species: hepatitis delta virus
• Mutation: L4 is UUCG tetraloop
• Tag / Fusion Protein:
  • TTT 3' extension prior to sgRNA

Gene/Insert 4

• Gene/Insert name: sgRNA
• Species: Synthetic
• Insert Size (bp): 100
• Mutation: guide targets LYP1 (CATAATAACGTCCAATAAAT)

Resource Information

• Articles Citing this Plasmid:
  • 20 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry