NaChBac pTracer CMV2
(Plasmid #60835)

• Purpose: Mammalian expression plasmid containing NaChBac gene with an EGFP reporter
• Depositing Lab: David Clapham
• Publication: Ren et al Science. 2001 Dec 14;294(5550):2372-5.

Backbone

• Vector backbone: Modified pTracer™-CMV2
• Backbone size w/o insert (bp): 6210
• Total vector size (bp): 6500
• Vector type: Mammalian Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NaChBac
• Alt name: NavBh
• Species: Bacillus Hallodurans C-125
• Insert Size (bp): 825
• GenBank ID: NP_242367.1
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGC AAA TGG GCG GTA GGC GTG
• 3′ sequencing primer: CACGCCTACCGCCCATTTGCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NOTE: The EGFP in this plasmid does has some discrepancies with the EGFP reported in the standard pTracer™-CMV2. These modifications do not appear to change the function or effectivity of the EGFP.