Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSECC
(Plasmid #60820)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60820 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLL3.3
  • Backbone size w/o insert (bp) 5878
  • Total vector size (bp) 13956
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    hSpCsn1
  • Species
    S. pyogenes
  • Insert Size (bp)
    4101
  • Promoter EFS
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACCCGACATTAGCGCTACAG
  • 3′ sequencing primer GCCGCTGCCGCTAGCTTTCTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cre
  • Insert Size (bp)
    1029
  • Mutation
    BsmBI site eliminated by C->A; E308G
  • Promoter EFS (after Cas9-2A)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCACCAACTTCAGCCTGCTG
  • 3′ sequencing primer CAACCCCAAACAACAACGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSECC was a gift from Tyler Jacks (Addgene plasmid # 60820 ; http://n2t.net/addgene:60820 ; RRID:Addgene_60820)
  • For your References section:

    Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Sanchez-Rivera FJ, Papagiannakopoulos T, Romero R, Tammela T, Bauer MR, Bhutkar A, Joshi NS, Subbaraj L, Bronson RT, Xue W, Jacks T. Nature. 2014 Oct 22. doi: 10.1038/nature13906. 10.1038/nature13906 PubMed 25337879