pSECC
(Plasmid #60820)

• Purpose: 3rd generation vector. Expresses a sgRNA of interest, Cas9 and Cre
• Depositing Lab: Tyler Jacks
• Publication: Sanchez-Rivera et al Nature. 2014 Oct 22. doi: 10.1038/nature13906.

Backbone

• Vector backbone: pLL3.3
• Backbone size w/o insert (bp): 5878
• Total vector size (bp): 13956
• Vector type: Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: hSpCsn1
• Species: S. pyogenes
• Insert Size (bp): 4101
• Promoter: EFS
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACCCGACATTAGCGCTACAG
• 3′ sequencing primer: GCCGCTGCCGCTAGCTTTCTT

Gene/Insert 2

• Gene/Insert name: Cre
• Insert Size (bp): 1029
• Mutation: BsmBI site eliminated by C->A; E308G
• Promoter: EFS (after Cas9-2A)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCCACCAACTTCAGCCTGCTG
• 3′ sequencing primer: CAACCCCAAACAACAACGTTT

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
  • GenBank pAF-U6-sgRNA-EFS-Cas9-2A-Cre-gBR cassette
• A portion of this plasmid was derived from a plasmid made by: Cas9 gene cloned from LentiCRISPR
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry