Skip to main content
Addgene

pcDNA3-CaMPARI W391F V398L
(Plasmid #60787)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60787 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5376
  • Total vector size (bp) 6684
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CaMPARI W391F V398L
  • Species
    Synthetic
  • Insert Size (bp)
    1308
  • Promoter CMV
  • Tag / Fusion Protein
    • Nuclear Export Signal (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer AGATGGCTGGCAACTAGAAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Eric Schreiter created this plasmid.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-CaMPARI W391F V398L was a gift from Loren Looger & Eric Schreiter (Addgene plasmid # 60787 ; http://n2t.net/addgene:60787 ; RRID:Addgene_60787)

  • For your References section:

    Neural circuits. Labeling of active neural circuits in vivo with designed calcium integrators. Fosque BF, Sun Y, Dana H, Yang CT, Ohyama T, Tadross MR, Patel R, Zlatic M, Kim DS, Ahrens MB, Jayaraman V, Looger LL, Schreiter ER. Science. 2015 Feb 13;347(6223):755-60. doi: 10.1126/science.1260922. 10.1126/science.1260922 PubMed 25678659
Related items:
Commonly requested with: