pTSara-N
(Plasmid #60721)

• Purpose: Expresses the N-terminal fragment of split T7 RNAP split a position 179. Insert is driven by PBAD. Contains a constitutive araC ORF
• Depositing Lab: Matthew Bennett
• Publication: Shis et al Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11.

Backbone

• Vector backbone: pBAD33
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 6040
• Modifications to backbone: Arabinose inducible ORF driving expression of the N-terminal fragment of T7 RNAP split between position 179-180
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Residues 1-179 of T7 RNAP
• Species: Synthetic; T7 Phage
• Insert Size (bp): 540
• Mutation: Only amino acids 1-179 of T7 RNAP
• GenBank ID: GI:216012
• Promoter: PBAD

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry