pTSara
(Plasmid #60720)

• Purpose: Expresses both fragments of T7 RNAP split at position 179. Both fragments are driven by the arabinose inducible promoter PBAD. Also contains a constitutive araC ORF
• Depositing Lab: Matthew Bennett
• Publication: Shis et al Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11.

Backbone

• Vector backbone: pBAD33
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 8600
• Modifications to backbone: Insertion of two arabinose inducible ORFs to drive the expression of both the N and C terminal fragment of T7 RNAP split at position 179.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: N Terminal fragment of T7 RNAP split betwen 179-180
• Species: Synthetic
• Insert Size (bp): 540
• Mutation: wt T7 RNAP split between positions 179 and 180
• GenBank ID: GI:216012
• Promoter: PBAD

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac
• 3′ sequencing primer: GATTATAGACACTTTTGTCGCGATGTTGTGTCTAATTTTGAAGTTAAC

Gene/Insert 2

• Gene/Insert name: N Terminal fragment of T7 RNAP split betwen 179-180
• Species: T7 Phage
• Insert Size (bp): 2118
• Mutation: T7 RNAP split between positions 179-180
• GenBank ID: GI:216012

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid is a heavily modified version of pTara:500.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry