pTara:500
(Plasmid #60717)

• Purpose: Expresses T7 RNAP from the arabinose inducible promoter PBAD with a RBS strength of 500 from the Salis RBS calculator. Also includes a constitutive araC ORF
• Depositing Lab: Matthew Bennett
• Publication: Shis et al Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11.

Backbone

• Vector backbone: pBAD33
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 8000
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: T7 RNAP
• Alt name: T7 RNA Polymerase
• Insert Size (bp): 2652
• GenBank ID: GI:216012
• Promoter: PBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (unknown if destroyed)
• 3′ cloning site: SalI, HindIII, SphI (unknown if destroyed)
• 5′ sequencing primer: acattgattatttgcacggcgtcacac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid was modified from pTara, originally described by Dr. Kathleen Matthews at Rice University.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry