pUCX
(Plasmid
#60681)
-
Purpose(Empty Backbone) E. coli expression plasmid, useful in conjunction with pUCXKT for positive selection cloning and expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60681 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
- Promoter tac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAll temps fine
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCTCGTATAATGTGTGG)
- 3′ sequencing primer GACCGCTTCTGCGTTCTGAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCX was a gift from David Ackerley (Addgene plasmid # 60681 ; http://n2t.net/addgene:60681 ; RRID:Addgene_60681) -
For your References section:
A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning. Prosser GA, Williams EM, Sissons JA, Walmsley KE, Parker MR, Ackerley DF. Biotechnol Lett. 2014 Sep 26. 10.1007/s10529-014-1673-4 PubMed 25257589
Map uploaded by the depositor.
