pSBtet-GP
(Plasmid #60495)

• Purpose: (Empty Backbone) SB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of GFP, rtTA and puromycin resistance gene
• Depositing Lab: Eric Kowarz
• Publication: Kowarz et al Biotechnol J. 2015 Feb 4. doi: 10.1002/biot.201400821.

Backbone

• Vector backbone: pUC19
• Backbone size (bp): 2021
• Vector type: Mammalian Expression ; Transposon
• Promoter: TCE & RPBSA
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CCTGGAGCCAATTCCAACTCT
• 3′ sequencing primer: CACTGCATTCTTGTTGTGGTT

Resource Information

• Supplemental Documents:
  • pSBtet-GP sequence
• Articles Citing this Plasmid:
  • 18 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 60495-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here