LeGO-iG2-wPRE-pA
(Plasmid #60489)

• Purpose: eGFP-expressing lentiviral vector with IRES and pA-signal; suitable for use as NRTLV (non-reverse transcribable lentiviral vector)
• Depositing Lab: Boris Fehse
• Publication: Mock et al Sci Rep. 2014 Sep 18;4:6409. doi: 10.1038/srep06409.

Backbone

• Vector backbone: LeGO
• Total vector size (bp): 8076
• Modifications to backbone: Insertion of BGH-pA (polyadenylation-signal of bovine growth hormone)into PvuII-site of previously described LeGO-iG2. BGH-pA-fragment was generated by PCR using the following primer (u58-fw: GCTGTACAAGTAACTGTGCCTTCTAG and u59-rev: GCTGTACAGCCATAGAGCCCAC).
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: any (like TOP10, XL10-Gold or Stbl)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IRES-eGFP; wPRE; BGH-pA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: As template for BGH-pA-PCR the previously described pAC_CMV_TALE_RM1_long_FokI_1317 was used (Mussolino, C. et al. A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res.39,9283–9293 (2011))

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry