pLenti-CaMKIIa-Archer1-EGFP
(Plasmid #60423)

• Purpose: Lentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing Archer1-EGFP fusion. Archer1's red fluorescence monitors changes in membrane voltage.
• Depositing Lab: Viviana Gradinaru
• Publication: Flytzanis et al Nat Commun. 2014 Sep 15;5:4894. doi: 10.1038/ncomms5894.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 9241
• Total vector size (bp): 10843
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Archer1-EGFP
• Alt name: ArchDETC
• Species: H. sodomense
• Insert Size (bp): 1602
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTCTCCGTTTGCACTCAGGAGC

Resource Information

• Supplemental Documents:
  • pLenti-CaMKIIa-Archer1-EGFP
• A portion of this plasmid was derived from a plasmid made by: This plasmid backbone containing wild-type Arch and a different fusion protein (pLenti-CaMKIIa-eArch 3.0-EYFP) was deposited at Addgene by the Deisseroth lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry