pLL7.0: hITSN1(1159-1509)-tgRFPt-SSPB WT
(Plasmid #60419)

• Purpose: Mammalian Expression of ITSN DH/PH-tgRFPt-Nano
• Depositing Lab: Brian Kuhlman
• Publication: Guntas et al Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22.

Backbone

• Vector backbone: pLentiLox7.0
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hITSN1-tgRFPt-SSPB
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2217
• Mutation: hITSN 1159-1509 // SSPB Y11K and A15E
• Entrez Gene: ITSN1 (a.k.a. ITSN, SH3D1A, SH3P17)
• Promoter: CMV
• Tag / Fusion Protein:
  • tgRFPt

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: PciI (not destroyed)
• 5′ sequencing primer: none
• 3′ sequencing primer: CAGCAACCAGGATTTATACAAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The SspB used in this construct contains two amino acid mutations that disrupt the natural dimerization of SspB. These mutations are Y11K and A15E (residue numbering from pdb code 1ou9). Here is the sequence around the mutated residues with the sites of mutation in parentheses: SSPKRP(K)LLR(E)YYDWLVDNS