Skip to main content
Addgene

pHR KIF17 (1-738)
(Plasmid #60406)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60406 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF17
  • Alt name
    Homodimeric Kinesin-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3264
  • Mutation
    Truncated version amino acids 1-738
  • Entrez Gene
    KIF17 (a.k.a. KIF17B, KIF3X, KLP-2, OSM-3)
  • Promoter SFFV
  • Tags / Fusion Proteins
    • sfGFP (C terminal on insert)
    • GB1 (C terminal on insert)
    • Strep-Tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaccctgcgccttatttgaa
  • 3′ sequencing primer caatagcatgatacaaaggc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR KIF17 (1-738) was a gift from Ron Vale (Addgene plasmid # 60406 ; http://n2t.net/addgene:60406 ; RRID:Addgene_60406)

  • For your References section:

    Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327
Related items:
Commonly requested with: