pRS424-TUB2 - human TUBB6 Cterminal tail
(Plasmid
#60403)
-
PurposeExpression of chimeric yeast beta tubulin (TUB2) - human beta5 tubulin Cterminal tail (TUBB6) using a GAL promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS424
-
Vector typeYeast Expression
-
Selectable markersTRP marker for yeast
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUB2
-
Alt nameYeast beta Tubulin - TUBB6 C-terminal tail
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1500
-
MutationTUB2 amino acids 429 - end, replaced with human TUBB6 sequence
-
GenBank IDYFL037W
- Promoter GAL
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer aacgtcaaggagaaaaaacc
- 3′ sequencing primer gggagggcgtgaatgtaagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
C-terminal tail is from TUBB6 (tubulin, beta 6 class V) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS424-TUB2 - human TUBB6 Cterminal tail was a gift from Ron Vale (Addgene plasmid # 60403 ; http://n2t.net/addgene:60403 ; RRID:Addgene_60403) -
For your References section:
Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327