pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail
(Plasmid
#60392)
-
PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) using a GAL promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepRS426
-
Vector typeYeast Expression
-
Selectable markersURA marker for yeast
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUB1
-
Alt nameYeast alpha Tubulin - human TUBA1a Cterminal tail
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1500
-
Mutationinternal 6xHis (see supplement figure 4), amino acid 1-440 yeast TUB1, 441-stop is from human TUBA1a amino acids
-
Entrez GeneTUB1 (a.k.a. YML085C)
- Promoter GAL
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer aacgtcaaggagaaaaaacc
- 3′ sequencing primer gggagggcgtgaatgtaagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail was a gift from Ron Vale (Addgene plasmid # 60392 ; http://n2t.net/addgene:60392 ; RRID:Addgene_60392) -
For your References section:
Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327