pRS424-TUB2-Cterminal6xHis
(Plasmid
#60386)
-
PurposeExpression of yeast beta tubulin (TUB2)-Cterminal 6xHis using a GAL promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS424
-
Vector typeYeast Expression
-
Selectable markersTRP marker for yeast
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTUB2
-
Alt nameYeast beta Tubulin
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1500
-
GenBank IDYFL037W
- Promoter GAL
-
Tag
/ Fusion Protein
- 6xHIS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer aacgtcaaggagaaaaaacc
- 3′ sequencing primer gggagggcgtgaatgtaagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Johnson V, Ayaz P, Huddleston P, Rice LM.
Design, overexpression, and purification of polymerization-blocked yeast αβ-tubulin mutants.
Biochemistry. 2011 Oct 11;50(40):8636-44. doi: 10.1021/bi2005174. Epub 2011 Sep 16.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS424-TUB2-Cterminal6xHis was a gift from Ron Vale (Addgene plasmid # 60386 ; http://n2t.net/addgene:60386 ; RRID:Addgene_60386) -
For your References section:
Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Sirajuddin M, Rice LM, Vale RD. Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16. 10.1038/ncb2920 PubMed 24633327