pRS426-TUB1
(Plasmid #60385)

• Purpose: Expression of yeast alpha tubulin (TUB1) using a GAL promoter
• Depositing Lab: Ron Vale
• Publication: Sirajuddin et al Nat Cell Biol. 2014 Apr;16(4):335-44. doi: 10.1038/ncb2920. Epub 2014 Mar 16.

Backbone

• Vector backbone: pRS426
• Vector type: Yeast Expression
• Selectable markers: URA marker for yeast

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TUB1
• Alt name: Yeast alpha Tubulin
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1500
• Entrez Gene: TUB1 (a.k.a. YML085C)
• Promoter: GAL

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: aacgtcaaggagaaaaaacc
• 3′ sequencing primer: gggagggcgtgaatgtaagc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Contains insert obtained from Luke Rice at UT Southwestern

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Johnson V, Ayaz P, Huddleston P, Rice LM.
Design, overexpression, and purification of polymerization-blocked yeast αβ-tubulin mutants.
Biochemistry. 2011 Oct 11;50(40):8636-44. doi: 10.1021/bi2005174. Epub 2011 Sep 16.