Skip to main content
Addgene

pGL4.23 C5_12
(Plasmid #60319)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60319 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.23-GW
  • Backbone manufacturer
    Ferrer Lab
  • Backbone size w/o insert (bp) 4283
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Non active element (nearest TSS C18orf26)
  • Alt name
    C18orf26
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

chromosome : chr18; start: 50489292 end: 50489931 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCAGCCCTTGGTCAAGAATAGT Rv primer used for cloning: TGTAAGCGGTTTGGGCAATCTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23 C5_12 was a gift from Jorge Ferrer (Addgene plasmid # 60319 ; http://n2t.net/addgene:60319 ; RRID:Addgene_60319)
  • For your References section:

    Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Pasquali L, Gaulton KJ, Rodriguez-Segui SA, Mularoni L, Miguel-Escalada I, Akerman I, Tena JJ, Moran I, Gomez-Marin C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, Garcia-Hurtado J, Maestro MA, Pattou F, Piemonti L, Berney T, Gloyn AL, Ravassard P, Gomez-Skarmeta JL, Muller F, McCarthy MI, Ferrer J. Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12. 10.1038/ng.2870 PubMed 24413736