pGL4.23 C3_25
(Plasmid #60305)

• Purpose: This plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.
• Depositing Lab: Jorge Ferrer
• Publication: Pasquali et al Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12.

Backbone

• Vector backbone: pGL4.23-GW
• Backbone manufacturer: Ferrer Lab
• Backbone size w/o insert (bp): 4283
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ROCK1 enhancer
• Alt name: ROCK1
• Species: H. sapiens (human)
• Entrez Gene: ROCK1 (a.k.a. P160ROCK, ROCK-I)
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: RVprimer3 (Promega): CTAGCAAAATAGGCTGTCCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

chromosome : chr18; start: 17001455 end: 17002128 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGAAGGGCAGAGAGGAGCA Rv primer used for cloning: TCTTCTGTGGCACATGGTGGGCTA