pGL4.23 C3_20
(Plasmid
#60303)
-
PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.23-GW
-
Backbone manufacturerFerrer Lab
- Backbone size w/o insert (bp) 4283
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCDKN1C enhancer
-
Alt nameCDKN1C
-
SpeciesH. sapiens (human)
-
Entrez GeneCDKN1C (a.k.a. BWCR, BWS, KIP2, WBS, p57, p57Kip2)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer RVprimer3 (Promega): CTAGCAAAATAGGCTGTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
chromosome : chr11; start: 2813990 end: 2815733 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCACGACTAGTGGCTCAAATC Rv primer used for cloning: TCCACTTGCTGGGCGAGAAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23 C3_20 was a gift from Jorge Ferrer (Addgene plasmid # 60303 ; http://n2t.net/addgene:60303 ; RRID:Addgene_60303) -
For your References section:
Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Pasquali L, Gaulton KJ, Rodriguez-Segui SA, Mularoni L, Miguel-Escalada I, Akerman I, Tena JJ, Moran I, Gomez-Marin C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, Garcia-Hurtado J, Maestro MA, Pattou F, Piemonti L, Berney T, Gloyn AL, Ravassard P, Gomez-Skarmeta JL, Muller F, McCarthy MI, Ferrer J. Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12. 10.1038/ng.2870 PubMed 24413736