pC1-HyPerRed-mito
(Plasmid #60247)

• Purpose: Mitochondria-targeted genetically encoded hydrogen peroxide indicator with red fluorescence.
• Depositing Lab: Vsevolod Belousov
• Publication: Ermakova et al Nat Commun. 2014 Oct 21;5:5222. doi: 10.1038/ncomms6222.

Backbone

• Vector backbone: pC1
• Backbone size w/o insert (bp): 3931
• Total vector size (bp): 5557
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HyPerRed-mito
• Species: Synthetic
• Insert Size (bp): 1626
• Promoter: CMV
• Tag / Fusion Protein:
  • Mitochondrial targeting signal (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggtgggaggtctatataag
• 3′ sequencing primer: cctctacaaatgtggtatgg

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry