pC1-mitoRexYFP
(Plasmid #60246)

• Purpose: Mitochondria-targeted genetically encoded fluorescent indicator for measuring NAD/NADH ratio.
• Depositing Lab: Vsevolod Belousov
• Publication: Bilan et al Biochim Biophys Acta. 2013 Nov 25. pii: S0304-4165(13)00519-9. doi: 10.1016/j.bbagen.2013.11.018.

Backbone

• Vector backbone: pC1
• Backbone size w/o insert (bp): 3930
• Total vector size (bp): 5523
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mitoRexYFP
• Species: Synthetic
• Insert Size (bp): 1593
• Promoter: CMV
• Tag / Fusion Protein:
  • Mitochondrial targeting signal (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggtgggaggtctatataag
• 3′ sequencing primer: cctctacaaatgtggtatgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry