pTXB1-Tn5
(Plasmid #60240)

• Purpose: IPTG-inducible expression of Transposon Tn5 fused to Mxe Intein and Chitin-binding domain.
• Depositing Lab: Rickard Sandberg
• Publication: Picelli et al Genome Res. 2014 Jul 30. pii: gr.177881.114.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6706
• Total vector size (bp): 8079
• Modifications to backbone: None
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Growth instructions: Growth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The depositing laboratory recommends E. coli strains NEB C3013 or ER2566 for protein expression.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tnpA from pBam1
• Alt name: Tn5 transposase
• Species: E. coli
• Insert Size (bp): 1428
• Mutation: E54K, L372P
• GenBank ID: HQ908071.1
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • Mxe intein - Chitin-binding domain (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba (not destroyed)
• 3′ cloning site: Lgu1/SapI) (destroyed during cloning)
• 5′ sequencing primer: T7 promoter primer
• 3′ sequencing primer: GATTGCCATGCCGGTCAAGG

Resource Information

• Addgene Notes:
  • Addgene diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Tn5 transposase from pBAM1 (Addgene Plasmid #60487)
• Articles Citing this Plasmid:
  • 26 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry