Skip to main content
Addgene

AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
(Plasmid #60228)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60228 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6397
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sgRNA
  • Alt name
    single guide RNA
  • Alt name
    guide RNA
  • Alt name
    gRNA
  • Insert Size (bp)
    102
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
  • 3′ sequencing primer NA
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cre recombinase
  • Alt name
    Cre
  • Insert Size (bp)
    1047
  • Promoter CBh
  • Tag / Fusion Protein
    • Cre-HA (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctgagcaagaggtaagggtttaagg
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Information for Cas9 mice:

JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9
(http://jaxmice.jax.org/strain/024857.html)

JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9
(http://jaxmice.jax.org/strain/024858.html)

NOTE: The CBh promoter is slightly truncated. There should be no effect on function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR was a gift from Feng Zhang (Addgene plasmid # 60228 ; http://n2t.net/addgene:60228 ; RRID:Addgene_60228)

  • For your References section:

    CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330
Related items:
Commonly requested with: