AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
(Plasmid #60226)

• Purpose: Expresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.
• Depositing Lab: Feng Zhang
• Publication: Platt et al Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2597
• Total vector size (bp): 6763
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA
• Alt name: single guide RNA
• Alt name: guide RNA
• Alt name: gRNA
• Insert Size (bp): 100
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTC
• 3′ sequencing primer: GACTACTGCACTTATATACGGTTCTCCC

Gene/Insert 2

• Gene/Insert name: Renilla luciferase
• Alt name: Rluc
• Insert Size (bp): 933
• Promoter: EFS
• Tag / Fusion Protein:
  • Rluc-P2A (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGAAAGTGATGTCGTGTACTGG
• 3′ sequencing primer: CAGCATTTTCTGCATGTTTTTCTG

Gene/Insert 3

• Gene/Insert name: Cre recombinase
• Alt name: Cre
• Insert Size (bp): 1047
• Promoter: EFS
• Tag / Fusion Protein:
  • Cre-HA (C terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCAATGCTATTGTTGAAGGTGCC
• 3′ sequencing primer: gtatccacatagcgtaaaaggagc

Resource Information

• Supplemental Documents:
  • Plasmid map and sequence
  • EXTENDED INFORMATION AND PROTOCOLS
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Information for Cas9 mice:

JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9
(http://jaxmice.jax.org/strain/024857.html)

JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9
(http://jaxmice.jax.org/strain/024858.html)