-
PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6763
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Alt namesingle guide RNA
-
Alt nameguide RNA
-
Alt namegRNA
-
Insert Size (bp)100
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
- 3′ sequencing primer GACTACTGCACTTATATACGGTTCTCCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRenilla luciferase
-
Alt nameRluc
-
Insert Size (bp)933
- Promoter EFS
-
Tag
/ Fusion Protein
- Rluc-P2A (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGGAAAGTGATGTCGTGTACTGG
- 3′ sequencing primer CAGCATTTTCTGCATGTTTTTCTG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
Insert Size (bp)1047
- Promoter EFS
-
Tag
/ Fusion Protein
- Cre-HA (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCC
- 3′ sequencing primer gtatccacatagcgtaaaaggagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9
(http://jaxmice.jax.org/strain/024857.html)
JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9
(http://jaxmice.jax.org/strain/024858.html)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR was a gift from Feng Zhang (Addgene plasmid # 60226 ; http://n2t.net/addgene:60226 ; RRID:Addgene_60226) -
For your References section:
CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330