AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
(Plasmid #60225)

• Purpose: Expresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA targeting LacZ. AAV backbone.
• Depositing Lab: Feng Zhang
• Publication: Platt et al Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2738
• Total vector size (bp): 6766
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA
• Alt name: single guide RNA
• Alt name: guide RNA
• Alt name: gRNA
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTC
• 3′ sequencing primer: GACTACTGCACTTATATACGGTTCTCCC

Gene/Insert 2

• Gene/Insert name: Renilla luciferase
• Alt name: Rluc
• Insert Size (bp): 933
• Promoter: EFS
• Tag / Fusion Protein:
  • Rluc-P2A (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWi (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGGAAAGTGATGTCGTGTACTGG
• 3′ sequencing primer: gcgcagggaggttctggtg

Gene/Insert 3

• Gene/Insert name: Cre recombinase
• Alt name: Cre
• Insert Size (bp): 1047
• Promoter: EFS
• Tag / Fusion Protein:
  • Cre-HA (C terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCAATGCTATTGTTGAAGGTGCC
• 3′ sequencing primer: gtatccacatagcgtaaaaggagc

Resource Information

• Supplemental Documents:
  • Plasmid map and sequence
  • EXTENDED INFORMATION AND PROTOCOLS

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Information for Cas9 mice:

JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9
(http://jaxmice.jax.org/strain/024857.html)

JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9
(http://jaxmice.jax.org/strain/024858.html)