Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mscv2.2-NAIP5
(Plasmid #60205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60205 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mscv2.2
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NAIP5
  • Species
    M. musculus (mouse)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AAGCCCTTTGTACACCCTAAGCC
  • 3′ sequencing primer CCTCACATTGCCAAAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mscv2.2-NAIP5 was a gift from Russell Vance (Addgene plasmid # 60205 ; http://n2t.net/addgene:60205 ; RRID:Addgene_60205)
  • For your References section:

    Molecular basis for specific recognition of bacterial ligands by NAIP/NLRC4 inflammasomes. Tenthorey JL, Kofoed EM, Daugherty MD, Malik HS, Vance RE. Mol Cell. 2014 Apr 10;54(1):17-29. doi: 10.1016/j.molcel.2014.02.018. Epub 2014 Mar 20. 10.1016/j.molcel.2014.02.018 PubMed 24657167