DYSF-Exon17-del
(Plasmid #60182)

• Purpose: Plasmid contains human dysferlin with exon 17 deleted. Deletion maintains the open reading frame.
• Depositing Lab: Jain Foundation
• Publication: Human dysferlin (unpublished)

Backbone

• Vector backbone: pUC57-Kan
• Backbone size w/o insert (bp): 2363
• Total vector size (bp): 8632
• Vector type: cloning vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Dysferlin
• Alt name: DYSF
• Species: H. sapiens (human)
• Insert Size (bp): 6269
• Mutation: Exon 17 has been deleted
• Entrez Gene: DYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gagcagattgtactgagagtgcacg
• 3′ sequencing primer: M13pUC-rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human dysferlin insert was synthesized by Genewiz

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry